Hey Hey I wasn't here today! I was at my annual concert featuring the ........
Well, not quite the Grateful Dead. Dead and Company with Bob Weir, Bill Kreutzman, Mickey Hart and John Mayer. It was awesome!
The hardest week of the year comes to an end. The remaining 7 days are gonna be a breeze. Except for the whole final thing.
The Chemistry students went to the library to try to solve a murder using chemistry and brain power. Next week begins the prep for Finals and completion of the work folders. The AP Biology students continued their work on their Final Project. It's due pretty soon! Chemistry students:
1. Make sure you have seen everything from Day 169 and you have turned in or emailed me the analysis of your diet. Everything is described in the blog entry. Read it! 2. Check out some of these games https://www.wisc-online.com/arcade/games/natural-science/chemistry/521/carbohydrates https://www.wisc-online.com/arcade/games/natural-science/chemistry/2092/carbohydrates https://www.wisc-online.com/arcade/games/natural-science/chemistry/3101/lipids-physical-characteristics https://www.wisc-online.com/arcade/games/natural-science/science-biology/3409/protein-synthesis-baseball https://biomanbio.com/HTML5GamesandLabs/LifeChemgames/protsynthracehtml5page.html Then, if you're interested, check out this murder mystery thing. I've never used it before but I think it may be decent. You need headphones for it. http://chemcollective.org/mr/game/game_survey/main.html There is only a few days left of school. That's pretty good if you're looking forward to summer vacation which for me is just fishing golf, reading, travel, eating, and other stuff. No big deal.
The Chemistry students reviewed protein synthesis today. You know, TACGTAGGCCTATAAAACGAATC, that stuff. We also checked out how bad mass-produced meat can be. It ain't good. The AP Biology students went to the library can continued work on the Final Project. This year went real fast, didn't it? I mean, it's not over yet but it's pretty close.
The Chemistry students learnt (that isn't a word but the first one of you to notice that learnt ain't a word gets a cash prize) about proteins and their structure. We also reviewed how DNA codes for proteins which is cool. The AP Biology students saw some examples of video projects that former students made for their Final Project. They also saw examples of written work from past students. OK, Chemistry students. Let's see what you know. Try these, in order, before we work on our food diaries.
http://carbchallenge.joslinresearch.org/ http://www.softschools.com/quizzes/chemistry/lipids/quiz6036.html https://www.visionlearning.com/en/library/Biology/2/Lipids/207/quiz https://www.nourishlife.org/learn/food-literacy-quiz/ Now use the link below to see if your diet and activity level is keeping you healthy. https://www.bcm.edu/cnrc-apps/healthyeatingcalculator/eatingCal.cfm Now do this: take the record of the food you ate that we began last Wednesday and went through Friday (add today if necessary) and pick out a typical 24 hour of food intake. Then, you will analyze each food item using MyFitnessPal. Just type in your food item in the search box. Next, you will record on a piece of paper (or a word document to email to me) how many calories, grams of carbohydrates, grams of protein and grams of fat for each food item you ate. This will be due into your folder or emailed to me by Friday of this week. We will have one other day (Thursday) in the library to complete this. Only 2 more Fridays to the end of the year. This year is 14/15ths of the way done! Only 1/15th left to go!
The Chemistry students checked out how some of our favorite foods are made which is pretty disgusting really. The students also updated their food journals. On Monday, we will start working with them. The AP Biology student continued their work on their Final Project which is not a euphemism. Some of the students were actually working. |
AuthorThis is my blog for everyday Archives
May 2019
Categories |
||||||||||||||||||||||||||||||||
RSS Feed